ID: 981770348_981770352

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 981770348 981770352
Species Human (GRCh38) Human (GRCh38)
Location 4:148300982-148301004 4:148301000-148301022
Sequence CCTGTTTTCCTCATGGAGCCCCA CCCCAGAAATTACAGGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 26, 3: 50, 4: 199} {0: 1, 1: 0, 2: 5, 3: 29, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!