ID: 981790370_981790373

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 981790370 981790373
Species Human (GRCh38) Human (GRCh38)
Location 4:148529585-148529607 4:148529598-148529620
Sequence CCATAGACCTTACAGTGGGACAA AGTGGGACAAGTTGTGCAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 12, 2: 248, 3: 439, 4: 557}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!