ID: 981795031_981795042 |
View in Genome Browser |
Spacer: 24 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 981795031 | 981795042 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:148585892-148585914 | 4:148585939-148585961 |
| Sequence | CCACCCTGCTTCAGCTTACCCTC | CAGTCCCGATGAGATGAGCCTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 2, 1: 122, 2: 666, 3: 1033, 4: 829} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||