ID: 981836189_981836197 |
View in Genome Browser |
Spacer: 25 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 981836189 | 981836197 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 4:149057238-149057260 | 4:149057286-149057308 |
Sequence | CCACCTCTAAAACTCCTGTTATA | CTCTTTGGGAATAAGAGGAGGGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 0, 2: 1, 3: 23, 4: 277} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |