ID: 981836190_981836198

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 981836190 981836198
Species Human (GRCh38) Human (GRCh38)
Location 4:149057241-149057263 4:149057287-149057309
Sequence CCTCTAAAACTCCTGTTATACAA TCTTTGGGAATAAGAGGAGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!