ID: 981841385_981841388

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 981841385 981841388
Species Human (GRCh38) Human (GRCh38)
Location 4:149116670-149116692 4:149116708-149116730
Sequence CCAGTCATTCTTGTGGCTGAATG ACAACCATATTGTGTTTGATGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!