ID: 981926640_981926646

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 981926640 981926646
Species Human (GRCh38) Human (GRCh38)
Location 4:150147685-150147707 4:150147718-150147740
Sequence CCTGGACTTCATAGAAAGTTGCC AACTGATGCTGGAAGTATGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 90} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!