ID: 981942862_981942866

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 981942862 981942866
Species Human (GRCh38) Human (GRCh38)
Location 4:150303874-150303896 4:150303889-150303911
Sequence CCCTCACCCTTTAAGAATCTTTG AATCTTTGTTTAACCAGATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 221} {0: 1, 1: 0, 2: 2, 3: 12, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!