ID: 981963607_981963612

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 981963607 981963612
Species Human (GRCh38) Human (GRCh38)
Location 4:150573827-150573849 4:150573878-150573900
Sequence CCTTTGTTTAGTGACTCATGTTT CTTTTAACACAGTAGGAACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 312} {0: 1, 1: 0, 2: 0, 3: 13, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!