ID: 981979560_981979564 |
View in Genome Browser |
Spacer: 14 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 981979560 | 981979564 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 4:150774667-150774689 | 4:150774704-150774726 |
Sequence | CCTGACATTGTGAAAAGACACAT | GGTTACTTCTAACCTTGTACTGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 2, 2: 14, 3: 33, 4: 247} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |