|
Left Crispr |
Right Crispr |
| Crispr ID |
981999229 |
981999232 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:151007134-151007156
|
4:151007166-151007188
|
| Sequence |
CCTTACATTTATGCTCAACTGAT |
AAGTGCCAAGGTAATTCAATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 14, 2: 98, 3: 424, 4: 1191} |
{0: 2, 1: 20, 2: 75, 3: 216, 4: 673} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|