ID: 982011878_982011884

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 982011878 982011884
Species Human (GRCh38) Human (GRCh38)
Location 4:151113441-151113463 4:151113488-151113510
Sequence CCACCATGCCTAGCTGGAAGGGA CTAGGTCAGTTTCTCAACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 71, 4: 634} {0: 1, 1: 0, 2: 3, 3: 24, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!