ID: 982033522_982033530

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 982033522 982033530
Species Human (GRCh38) Human (GRCh38)
Location 4:151324743-151324765 4:151324758-151324780
Sequence CCTACAGAAAACTGGTGAGCTCG TGAGCTCGGCGGCTGGGGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 28, 4: 583}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!