ID: 982073841_982073849

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 982073841 982073849
Species Human (GRCh38) Human (GRCh38)
Location 4:151719359-151719381 4:151719380-151719402
Sequence CCCCCCACAGCAGGGCTGGCCCA CAGCTCTGAGAACTTGCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 409} {0: 1, 1: 0, 2: 0, 3: 35, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!