ID: 982094808_982094815

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 982094808 982094815
Species Human (GRCh38) Human (GRCh38)
Location 4:151912108-151912130 4:151912149-151912171
Sequence CCTGAGCTACAGCCCTGAGGCTG CCCATCCCTGAGAGACCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 304} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!