ID: 982095223_982095231

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 982095223 982095231
Species Human (GRCh38) Human (GRCh38)
Location 4:151916065-151916087 4:151916098-151916120
Sequence CCATGCTGAATAGCACTGATTGT CCTGGTTGTACCTGCAATGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!