ID: 982107606_982107613

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 982107606 982107613
Species Human (GRCh38) Human (GRCh38)
Location 4:152024390-152024412 4:152024414-152024436
Sequence CCTCCTTAAGTCTGGACTCTATG AGATCGTGGGAGGTCTTCTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!