ID: 982181076_982181092

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 982181076 982181092
Species Human (GRCh38) Human (GRCh38)
Location 4:152748820-152748842 4:152748871-152748893
Sequence CCTGCAGGCCCACCTCGACATGA AGCAGGTTGATGGCGGTAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 312} {0: 1, 1: 0, 2: 11, 3: 53, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!