|
Left Crispr |
Right Crispr |
| Crispr ID |
982189039 |
982189045 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:152834782-152834804
|
4:152834803-152834825
|
| Sequence |
CCCACAGCTCTCCTAGGCAGTGG |
GGCCCAGTAGGGACTCTGTGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 16, 3: 119, 4: 373} |
{0: 13, 1: 584, 2: 1377, 3: 1663, 4: 1501} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|