ID: 982201260_982201271

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 982201260 982201271
Species Human (GRCh38) Human (GRCh38)
Location 4:152963272-152963294 4:152963308-152963330
Sequence CCATTAGCAGATTCCTGAGTTGT CTATAGGGCTGAAGGGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 195} {0: 1, 1: 0, 2: 1, 3: 16, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!