ID: 982224765_982224768

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 982224765 982224768
Species Human (GRCh38) Human (GRCh38)
Location 4:153155387-153155409 4:153155402-153155424
Sequence CCACTGTACTTTAAAAAGAATAT AAGAATATGCAGAAATTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 65, 4: 616} {0: 1, 1: 0, 2: 2, 3: 38, 4: 517}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!