ID: 982225860_982225865

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 982225860 982225865
Species Human (GRCh38) Human (GRCh38)
Location 4:153165771-153165793 4:153165816-153165838
Sequence CCATCCTCACTCTCCTTTTCCTT CTGTGTATTCTCATATTTCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 27, 3: 328, 4: 2690} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!