ID: 982235668_982235677

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 982235668 982235677
Species Human (GRCh38) Human (GRCh38)
Location 4:153249257-153249279 4:153249286-153249308
Sequence CCGCCTTCTTTTCTTCCGCCTGA CTCGGCTCCCGCCTCGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 478} {0: 1, 1: 0, 2: 0, 3: 28, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!