ID: 982235680_982235690

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 982235680 982235690
Species Human (GRCh38) Human (GRCh38)
Location 4:153249294-153249316 4:153249327-153249349
Sequence CCGCCTCGGGGCGGGGCCTGTTG CGGGCCCCGGCAGAGCCTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 138} {0: 1, 1: 0, 2: 0, 3: 37, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!