ID: 982261071_982261086

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 982261071 982261086
Species Human (GRCh38) Human (GRCh38)
Location 4:153494891-153494913 4:153494935-153494957
Sequence CCTGCTCTGCCGGGTGTTCACCC AGTGTGAGAGGGGTCTGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 103} {0: 1, 1: 0, 2: 2, 3: 62, 4: 628}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!