ID: 982272430_982272439

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 982272430 982272439
Species Human (GRCh38) Human (GRCh38)
Location 4:153604945-153604967 4:153604978-153605000
Sequence CCACCCCTTTGGCCTCCAGAAGT TAGGCGTGAGCCACCGAACCTGG
Strand - +
Off-target summary No data {0: 3, 1: 694, 2: 13975, 3: 80306, 4: 151771}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!