|
Left Crispr |
Right Crispr |
| Crispr ID |
982272431 |
982272439 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:153604948-153604970
|
4:153604978-153605000
|
| Sequence |
CCCCTTTGGCCTCCAGAAGTGCT |
TAGGCGTGAGCCACCGAACCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 185, 2: 5469, 3: 70503, 4: 159635} |
{0: 3, 1: 694, 2: 13975, 3: 80306, 4: 151771} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|