ID: 982272438_982272439

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 982272438 982272439
Species Human (GRCh38) Human (GRCh38)
Location 4:153604960-153604982 4:153604978-153605000
Sequence CCAGAAGTGCTGGGATTATAGGC TAGGCGTGAGCCACCGAACCTGG
Strand - +
Off-target summary {0: 541, 1: 26095, 2: 254812, 3: 283697, 4: 270502} {0: 3, 1: 694, 2: 13975, 3: 80306, 4: 151771}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!