ID: 982321731_982321735

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 982321731 982321735
Species Human (GRCh38) Human (GRCh38)
Location 4:154083917-154083939 4:154083958-154083980
Sequence CCATTCTCCTCATGCTGTTTCAA TCCTGTCCTGGCTCTCCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 371} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!