ID: 982469377_982469381

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 982469377 982469381
Species Human (GRCh38) Human (GRCh38)
Location 4:155769055-155769077 4:155769089-155769111
Sequence CCTTCTTCCTTCATCTTCTCCAA TACCAGTTAGAGGAAGTATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 96, 4: 1047} {0: 1, 1: 0, 2: 0, 3: 8, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!