ID: 982524136_982524140

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 982524136 982524140
Species Human (GRCh38) Human (GRCh38)
Location 4:156456319-156456341 4:156456365-156456387
Sequence CCAAAGTCAGAATGGCGATTATT CTGGTGAGGTTGAGGAAAAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 15, 2: 310, 3: 1355, 4: 3476}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!