ID: 982560301_982560307

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 982560301 982560307
Species Human (GRCh38) Human (GRCh38)
Location 4:156921439-156921461 4:156921478-156921500
Sequence CCAGACATCCAGAGAACTTGGTG AAGGAGGAGGAGAAGGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 143} {0: 5, 1: 82, 2: 431, 3: 1929, 4: 7080}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!