ID: 982597889_982597894

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 982597889 982597894
Species Human (GRCh38) Human (GRCh38)
Location 4:157407807-157407829 4:157407853-157407875
Sequence CCAATCAATAGCTGCATACCAGG TCAAGAAATGAAACTGCATCTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 24, 3: 247, 4: 430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!