ID: 982600519_982600529

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 982600519 982600529
Species Human (GRCh38) Human (GRCh38)
Location 4:157443536-157443558 4:157443588-157443610
Sequence CCTGTCAGTGGTCTATGGCACTG ACTGGTGACCAGGTGTGGGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!