ID: 982683319_982683328

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 982683319 982683328
Species Human (GRCh38) Human (GRCh38)
Location 4:158458903-158458925 4:158458941-158458963
Sequence CCCTCCACTTTCCAAAGACAGAG GTCACCACCATCATTTGACAGGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 111, 3: 287, 4: 2389} {0: 1, 1: 0, 2: 0, 3: 12, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!