ID: 982683319_982683329 |
View in Genome Browser |
Spacer: 16 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 982683319 | 982683329 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:158458903-158458925 | 4:158458942-158458964 |
| Sequence | CCCTCCACTTTCCAAAGACAGAG | TCACCACCATCATTTGACAGGGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 8, 2: 111, 3: 287, 4: 2389} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||