ID: 982683486_982683495

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 982683486 982683495
Species Human (GRCh38) Human (GRCh38)
Location 4:158459943-158459965 4:158459990-158460012
Sequence CCCCCAGCCACTGCACTCTCCTT CATGCCATACAGCTGCTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 60, 4: 579} {0: 1, 1: 3, 2: 13, 3: 36, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!