ID: 982691926_982691930

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 982691926 982691930
Species Human (GRCh38) Human (GRCh38)
Location 4:158558216-158558238 4:158558267-158558289
Sequence CCTTCCTCATTGGTGTCCTCATT TTTGCAAATGCACACACAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 275} {0: 1, 1: 0, 2: 2, 3: 25, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!