ID: 982712176_982712190

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 982712176 982712190
Species Human (GRCh38) Human (GRCh38)
Location 4:158768865-158768887 4:158768893-158768915
Sequence CCTCCCGCCGGGGTTACGTGAGC GCGGGCGGCCGCCGGGCCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!