ID: 982712198_982712211

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 982712198 982712211
Species Human (GRCh38) Human (GRCh38)
Location 4:158768919-158768941 4:158768951-158768973
Sequence CCGCCGGGGCCGCCGCGCTCCTC CGCCGCCGCCGTGGGGCTGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 60, 4: 379} {0: 1, 1: 0, 2: 2, 3: 42, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!