ID: 982743079_982743081

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 982743079 982743081
Species Human (GRCh38) Human (GRCh38)
Location 4:159078375-159078397 4:159078399-159078421
Sequence CCAAGTTTCTGAATTTCGAAAAG TGAGAGTGCGGAGTTCCTACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!