ID: 982745785_982745793

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 982745785 982745793
Species Human (GRCh38) Human (GRCh38)
Location 4:159103322-159103344 4:159103340-159103362
Sequence CCGGGCCGGGTGCTCTGGCCGCG CCGCGGCGGCGCCGGCGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 194} {0: 1, 1: 0, 2: 31, 3: 326, 4: 1183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!