ID: 982745986_982746001

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 982745986 982746001
Species Human (GRCh38) Human (GRCh38)
Location 4:159104008-159104030 4:159104040-159104062
Sequence CCCCCGCGGGCCCCGCGCCGCCG TTTGGCTGATTAGTCGCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 17, 3: 129, 4: 888} {0: 1, 1: 0, 2: 0, 3: 0, 4: 23}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!