ID: 982745987_982746003 |
View in Genome Browser |
Spacer: 12 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 982745987 | 982746003 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 4:159104009-159104031 | 4:159104044-159104066 |
Sequence | CCCCGCGGGCCCCGCGCCGCCGC | GCTGATTAGTCGCGGGCGGGCGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 3, 2: 20, 3: 146, 4: 904} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |