ID: 982745988_982746008

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 982745988 982746008
Species Human (GRCh38) Human (GRCh38)
Location 4:159104010-159104032 4:159104063-159104085
Sequence CCCGCGGGCCCCGCGCCGCCGCC GCGGGCGGGCGCAGCGCGCAGGG
Strand - +
Off-target summary {0: 2, 1: 6, 2: 19, 3: 197, 4: 1030} {0: 1, 1: 1, 2: 4, 3: 34, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!