ID: 982745992_982746007

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 982745992 982746007
Species Human (GRCh38) Human (GRCh38)
Location 4:159104019-159104041 4:159104062-159104084
Sequence CCCGCGCCGCCGCCGCCGCGGTT GGCGGGCGGGCGCAGCGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 57, 3: 474, 4: 2596} {0: 1, 1: 1, 2: 13, 3: 99, 4: 658}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!