ID: 982910397_982910400

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 982910397 982910400
Species Human (GRCh38) Human (GRCh38)
Location 4:161134502-161134524 4:161134530-161134552
Sequence CCACCTAGAAAGCATCTTCTCTT GAGCCATATGGAAAGCTGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 249} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!