ID: 982930956_982930959

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 982930956 982930959
Species Human (GRCh38) Human (GRCh38)
Location 4:161407318-161407340 4:161407371-161407393
Sequence CCACAAAAACAGAGATTTCTACT GAGAGAAAACTGAATGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 335} {0: 1, 1: 0, 2: 5, 3: 77, 4: 696}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!