ID: 982946426_982946435

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 982946426 982946435
Species Human (GRCh38) Human (GRCh38)
Location 4:161629992-161630014 4:161630028-161630050
Sequence CCTATAGTGGAGTCTTCCTCAGA GCCTCTTAATGGGGGAATCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!