ID: 983028763_983028768

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 983028763 983028768
Species Human (GRCh38) Human (GRCh38)
Location 4:162771904-162771926 4:162771929-162771951
Sequence CCAATATATATGTCCTCCAGAAC AGAGAAGAGGAGAGGAGATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 151} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!